Selecciona tu fondo: Selecciona tu fondo: Regístrate para guardar tu selección Cerrar
Tienda Donate
Huntington's Disease Youth Organization

El gen de la Enfermedad de Huntington: Bajo el microscopio

En HDYO tenemos más información sobre la EH disponible para jóvenes, padres y profesionales en nuestra página:

www.hdyo.org

La Enfermedad de Huntington es causada por la expansión de un gen determinado del ADN de una persona. Este artículo trata de dicho gen y echa un vistazo a esa “expansión”. También mostraremos árboles genealógicos para analizar cómo se hereda y se transmite el gen.

Genes, cromosomas y ADN

DNA, chromosomes and genes

Primero expliquemos unos conceptos básicos, empezando por el ADN. El ADN es el nombre de los compuestos químicos con los que están hechos nuestros genes. Las siglas “ADN” significan Ácido Desoxirribonucleico (fácil, ¿no?). No es de extrañar que nadie use el nombre completo, es mucho más fácil pronunciar y recordar sólo ADN.

Heredamos el ADN de nuestros padres, y ellos, a su vez, lo heredaron de los suyos y así sucesivamente. Nuestro ADN decide quiénes somos, qué aspecto tenemos y cómo crecemos. Nuestro ADN decide nuestro color de pelo, de ojos, altura, ser hombre o mujer e incluso aspectos de nuestra personalidad.

ADN es el nombre de los compuestos químicos y los genes es lo que llamamos las instrucciones que están almacenadas en el ADN. Tenemos muchos genes – unos 23.000 para ser exactos, en todas las células de nuestro cuerpo. Cada gen es un conjunto de instrucciones- como una receta. El gen le dice a la célula cómo tiene que fabricar un compuesto químico llamado proteína. Las proteínas son las máquinas que hacen todo el trabajo importante en nuestras células, desde producir reacciones químicas hasta pasar mensajes de una célula a otra.

Los genes están unidos como salchichas y empaquetados en los llamados cromosomas. Hay 46 cromosomas en total. 23 proceden de un progenitor y 23 del otro. Cada célula de nuestro cuerpo contiene una copia de los 46 cromosomas.

Mutaciones genéticas. El gen de la Enfermedad de Huntington

Ahora que tenemos los conocimientos básicos, vamos a echar un vistazo al gen de la Enfermedad de Huntington. A veces se producen cambios (llamados “mutaciones” por los investigadores) en los cromosomas o los genes. Estos cambios pueden alterar el modo en que el cuerpo funciona y causar trastornos genéticos. Incluso un cambio diminuto en el gen puede causar un cambio dramático en la proteína. Imagina una receta en la que el chef dice que hay que hornear una tarta durante 400 minutos en lugar de 40 y te harás una idea de que un cambio tan pequeño en nuestros genes puede causar grandes problemas.

En 1993 un equipo de investigadores descubrió el gen responsable de la Enfermedad de Huntington en el cromosoma 4. Descubrieron que una parte del gen se repetía una y otra vez, como un tartamudeo o como cuando presionas una tecla del teclado del ordenador demasiado tieeeeeeeeeeeeeeeeeeeeeeeeempo. Esta repetición es lo que causa el desarrollo de la enfermedad de Huntington y se conoce como “repetición CAG”.

¿Qué es una repetición CAG?

CAG repeats

Si te estás preguntando por qué la repetición de la Enfermedad de Huntington se llama repetición CAG, bien, al igual que “ADN”, es una abreviatura de palabras científicas complicadas. Básicamente el ADN está formado por cuatro bases conocidas como adenina (que se abrevia con una A), citosina ©, guanina (G), y timina (T). Estas bases son el código de todo nuestro ADN y genes. Cada gen tiene un código diferente y, bueno, como los ciéntificos son vagos y no quieren escribir todas estas palabras complicadas continuamente, sólo utilizan las abreviaturas. Así que las cuatro bases del ADN son conocidas como A, C, G y T, y si alguien quisiera escribir un código genético sería algo parecido a esto: AAGTCCTGACTGGGACCTTGAGA CCTAG.

Si un gen es como una receta, entonces las bases son como el alfabeto de letras que forma las instrucciones de la receta. Los genes sólo usan un alfabeto muy simple con cuatro letras. Pero su escritura es igual de importante.

El gen que causa la Enfermedad de Huntington contiene una sección en la que las bases C, A y G se han repetido muchas veces- la “repetición CAG”. La mayoría de las copias normales del gen contienen entre 10 y 20 repeticiones, pero a veces la repetición se alarga y entonces es cuando empieza a causar problemas.

Repeticiones CAG

Todo el mundo tiene dos copias del gen de la Enfermedad de Huntington, tanto si están en riesgo como si no. Se hereda una copia de cada progenitor. Y cada gen de la Enfermedad de Huntington contiene un número de repeticiones CAG en ese gen.

Lo que causa el desarrollo de la enfermedad es el número de veces que se repite el CAG. Para explicarlo de una forma sencilla, las personas con enfermedad de Huntington tienen repeticiones más largas que los que no padecen la enfermedad. Y para que sea más sencillo vamos a dividir las diferentes situaciones en 4 casos. Es suficiente con tener una de las copias expandida para tener la enfermedad.

Por debajo de 26 (no afectado)

Como hemos dicho anteriormente, todos tenemos un número de repeticiones de CAG en el gen de la Enfermedad de Huntington (incluso aquéllos que no pertenecen a una familia afectada por la Enfermedad de Huntington). La mayoría de la gente que no tiene la Enfermedad de Huntington tiene alrededor de 10-20 repeticiones CAG. De hecho, hasta 26 repeticiones no hay ningún problema. Pero una vez que se supera eso, puede haber complicaciones.

40 o más repeticiones (afectado)

Por desgracia, cualquiera con 40 repeticiones CAG o más, por desgracia, desarrollará la enfermedad de Huntington a lo largo de su vida, y sus hijos tendrán un 50% de riesgo de heredarla, también. La mayoría de la gente con enfermedad de Huntington tiene entre 40 y 50 repeticiones CAG.

Las repeticones entre 27 y 39 son bastante poco frecuentes. Es un poco más complicado, y de hecho los científicos no las entienden del todo, así que a veces se refieren a ellas como la “zona gris”.

27-35 repeticiones CAG (riesgo para futuras generaciones)

La buena noticia sobre las repeticiones entre 27 y 35 es que la persona no desarrollará la enfermedad de Huntington. Sin embargo, hay un pequeño riesgo (alrededor del 5%) de que sus hijos puedan estar en riesgo de la EH ya que en este caso las repeticiones pueden aumentar al pasarlas a un hijo, con lo que se saldría de este intervalo y se colocaría en la zona en la que el hijo puede desarrollar EH.

36-39 repeticiones CAG (penetrancia reducida)

Las personas con repeticiones en este intervalo pueden desarollar la enfermedad de Huntington o no. Podrían tener síntomas de la enfermedad de Huntington a una edad más avanzada. A veces es tan avanzada que pueden morir de viejos antes de que aparezcan síntomas. Sin embargo, el riesgo de transmitir la enfermedad a sus hijos sigue siendo del 50%. Los científicos llaman a este intervalo “de penetrancia reducida”.

Dato: el número de repeticiones CAG es lo que cuentan los técnicos del laboratorio cuando alguien se hace un análisis genético para la Enfermedad de Huntington.

Heredar el gen expandido de la Enfermedad de Huntington

En definitiva, si el gen del Huntington tiene demasiadas repeticiones CAG causa la Enfermedad de Huntington. Ahora vamos a ver cómo se hereda ese gen expandido y cómo se puede transmitir el gen en la familia.

Riesgo del 50%

50% risk

Las personas tienen la Enfermedad de Huntington porque heredan el gen expandido de un progenitor. Tenemos dos copias de cada gen – uno de la madre y otro del padre- ya que heredamos una copia de cada cromosoma de cada progenitor.

Así que una persona con la Enfermedad de Huntington tiene dos copias del gen Huntington: una de ellas está expandida (con muchas repeticiones CAG) y la otra es normal.

Una persona que no tiene la Enfermedad de Huntington también tiene dos copias del gen de la Enfermedad de Huntington, pero las dos son normales.

Así que un niño con un progenitor que tiene la Enfermedad de Huntington tiene un gen normal de un progenitor no afectado, pero podría haber heredado o bien el gen expandido o el normal del progenitor con la Enfermedad de Huntington.

Esto hace que el riesgo de heredar el gen expandido sea del 50%.

Técnicamente, hay cuatro resultados posibles a la hora de transmitir los genes. Dos de estos resultados terminan con el hijo heredando el gen expandido y los otros dos no – así que las probabilidades son del 50%. Pero para que se entienda mejor, puedes quitar el progenitor que no tiene la Enfermedad de Huntington y concentrarte sólo en si el hijo ha heredado el gen expandido o el normal del progenitor con la Enfermedad de Huntington. De cualquier modo, el riesgo sigue siendo del 50%.

Que una persona herede el gen expandido o el normal es pura casualidad, y por eso puede que oigas que se compara el riesgo de tener la Enfermedad de Huntington con lanzar una moneda al aire. Cada individuo tiene su propio riesgo del 50%, así que es como si cada uno tuviéramos que lanzar nuestra propia moneda en lo relativo a su propio riesgo.

Un 25% de probabilidad

25% grandchild risk

Si embargo, para algunas personas, el riesgo no es del 50%. Por ejemplo, si el abuelo de un niño tiene la Enfermedad de Huntington, pero el progenitor en riesgo no se ha hecho el test predictivo, entonces el niño tiene una probabilidad del 25% de haber heredado el gen.

Eso es porque no sabemos si el progenitor tiene el gen expandido o no. Si el progenitor sí tiene el gen expandido, entonces el riesgo del niño será del 50%.

Si el progenitor no tiene el gen expandido, entonces el riesgo baja al 0% - lo que significa que no hay riesgo ninguno para el niño. Todo depende realmente de qué genes haya heredado el progenitor. Hasta que no lo sepamos, el riesgo del hijo es del 25%.

Autosómico dominante

Si una persona tiene un gen expandido y un gen normal, ¿cómo es que el gen expandido toma el control y causa la enfermedad de Huntington? ¿Por qué no lucha el gen normal? Bueno, no hay más que mirar el término “autosómico dominante”. Por desgracia, la enfermedad de Huntington se conoce como un “trastorno autosómico dominante”, lo que significa que aunque sólo una copia de los dos genes esté expandida, es suficiente para causar la enfermedad. En otras palabras, predomina sobre el gen normal. Por eso sólo un gen expandido es suficiente para causar la enfermedad y no dos.

En resumen, esta sección ha explicado que el gen que causa la enfermedad de Huntington está expandido porque tiene demasiadas “repeticiones CAG”, y que esas repeticiones CAG se pueden dividir en cuatro intervalos. Hemos visto qué significa el riesgo de heredar la Enfermedad de Huntington y cómo sucede. Y, a pesar de que algunos términos son complicados como “autosómico dominante”, ojalá hayamos conseguido arrojar luz y no confundir más. Si aún tienes algunas dudas, utiliza la sección haz una pregunta, donde los expertos te darán unas magníficas respuestas , o si no, puedes contactar con HDYO directamente si quieres preguntar algo en privado.